Review



93521 lectin  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc 93521 lectin
    93521 Lectin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/93521+lectin/Cannabinoid+Receptor+1+Downstream+Signaling+Antibody+Sampler+Kit/pm30332655-251-91-84
    Average 90 stars, based on 3 article reviews
    93521 lectin - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Paxillin-Mediated Recruitment of Calcineurin to the Contractile Ring Is Required for the Correct Progression of Cytokinesis in Fission Yeast.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-HA tag antibody-ChIP Grade Abcam Cat# ab9110, RRID:AB_307019 rabbit GFP tag polyclonal antibody Invitrogen Cat#A-6455;RRID AB_221570 rat anti-HA-peroxidase, high affinity (3F10) Roche Cat# 12013819001, RRID:AB_390917 Living colors A.v. monoclonal antibody (JL8) Clontech Cat#632380 RRID:AB_10013427 anti-GST-HRP conjugate GE Healthcare Cat#RPN1236, RRID:AB_771429 mouse anti-actin monoclonal (C4) MP biomedicals Cat# 08691001, RRID:AB_2335127 Chemicals, Peptides, and Recombinant Proteins Amylose resin New England Biolabs Cat#E8021S Glutathione Sepharose 4B GE Healthcare Cat#17-0756-01 Protein A Sepharose CL-4B GE Healthcare Cat#17-0780-01 Protease/Phosphatase inhibitor cocktail (100X) Cell Signaling Cat#5872S Phos-tag acrylamide AAL-107 Wako Cat304-93521 Lectin from Glycine max (soybean) Sigma Cat#L-1395-5mg Lambda protein phosphatase New England Biolabs Cat#P0753S CN (human) recombinant Enzo Cat#BML-SE163-5000 Calmodulin (human) recombinant Enzo Cat#BML-SE329-0001 CN assay buffer (2X) Enzo Cat#BML-KI128-0020 Deposited Data Raw Data This study Mendeley Data; https://doi.org/10.17632/ bp87npk532.1 Experimental Models: Organisms/Strains Fission yeast strains used in this study are detailed in Table S1 N/A N/A Oligonucleotides Generation of Pxl1-M3 mutation; Fw primer:50 CGCGGATCC ATATGCATTCACCAATTCCAGAAT30 Biomers N/A Generation of Pxl1-M3 mutation; Rv primer:50 CTACGAT TGGAAAGTTTACTGGATTTCgcagcAGcAgcAGcAGc AAGTTGTTTGGATGCGAAGGTTTTTTGTCTG 30 Biomers N/A Generation of Pxl1-M4 mutation; Fw primer: 50 GCAA GAAATGCCGTAAAgCCgcTgcGGcGgcCgc TGTAAAAGGGTCTGATGGTGAATATCATAG 30 Biomers N/A Generation of Pxl1-M4 mutation; Rv primer: 50 CGCGGA TCCTTAATCCAAATTAAACTTGACTGA 30 Biomers N/A Generation of N-Pxl1-Ppb1 chimera; Fw primer: 50 TATATGCT AGCATGACTTCGGGTCCTCATAATT 30 Sigma-Aldrich N/A Generation of N-Pxl1-Ppb1 chimera; Rv primer: 50 ATATAGG ATCCTACAAAGAGCTTTTCTTATCTG 30 Sigma-Aldrich N/A Creation of MBP-PPb1-HA; Fw primer: 50 ATATAT TCT AGA ATGACTTCGGGTCCTCATAATTTAG 30 Sigma-Aldrich N/A Creation of MBP-PPb1-HA; Rv primer: 50 ATATAT TCT AGA TCAGCACTGAGCAGCGTAATC 30 Sigma-Aldrich N/A Recombinant DNA pJK148-GFP-Pxl1-M3 This study N/A pJK148-GFP-Pxl1-M4 This study N/A pJK148-GFP-N-Pxl1-Ppb1 This study N/A (Continued on next page) e1 Cell Reports 25, 772–783.e1–e4, October 16, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER pJK148-N-Pxl1-Ppb1 This study N/A pJC20-GST-Pxl1 This study N/A pJC20-GST-Pxl1-M3 This study N/A pJC20-GST-Pxl1-M4 This study N/A pMAL-p2-Ppb1-HA This study N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ SoftWorx software 6.0 GE Healthcare N/A Graphpad Prism Graphpad Software https://www.graphpad.com Other m-slide 8 well uncoated Ibidi Cat#80821

    Mutagenesis:

    Article Title: Paxillin-Mediated Recruitment of Calcineurin to the Contractile Ring Is Required for the Correct Progression of Cytokinesis in Fission Yeast.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-HA tag antibody-ChIP Grade Abcam Cat# ab9110, RRID:AB_307019 rabbit GFP tag polyclonal antibody Invitrogen Cat#A-6455;RRID AB_221570 rat anti-HA-peroxidase, high affinity (3F10) Roche Cat# 12013819001, RRID:AB_390917 Living colors A.v. monoclonal antibody (JL8) Clontech Cat#632380 RRID:AB_10013427 anti-GST-HRP conjugate GE Healthcare Cat#RPN1236, RRID:AB_771429 mouse anti-actin monoclonal (C4) MP biomedicals Cat# 08691001, RRID:AB_2335127 Chemicals, Peptides, and Recombinant Proteins Amylose resin New England Biolabs Cat#E8021S Glutathione Sepharose 4B GE Healthcare Cat#17-0756-01 Protein A Sepharose CL-4B GE Healthcare Cat#17-0780-01 Protease/Phosphatase inhibitor cocktail (100X) Cell Signaling Cat#5872S Phos-tag acrylamide AAL-107 Wako Cat304-93521 Lectin from Glycine max (soybean) Sigma Cat#L-1395-5mg Lambda protein phosphatase New England Biolabs Cat#P0753S CN (human) recombinant Enzo Cat#BML-SE163-5000 Calmodulin (human) recombinant Enzo Cat#BML-SE329-0001 CN assay buffer (2X) Enzo Cat#BML-KI128-0020 Deposited Data Raw Data This study Mendeley Data; https://doi.org/10.17632/ bp87npk532.1 Experimental Models: Organisms/Strains Fission yeast strains used in this study are detailed in Table S1 N/A N/A Oligonucleotides Generation of Pxl1-M3 mutation; Fw primer:50 CGCGGATCC ATATGCATTCACCAATTCCAGAAT30 Biomers N/A Generation of Pxl1-M3 mutation; Rv primer:50 CTACGAT TGGAAAGTTTACTGGATTTCgcagcAGcAgcAGcAGc AAGTTGTTTGGATGCGAAGGTTTTTTGTCTG 30 Biomers N/A Generation of Pxl1-M4 mutation; Fw primer: 50 GCAA GAAATGCCGTAAAgCCgcTgcGGcGgcCgc TGTAAAAGGGTCTGATGGTGAATATCATAG 30 Biomers N/A Generation of Pxl1-M4 mutation; Rv primer: 50 CGCGGA TCCTTAATCCAAATTAAACTTGACTGA 30 Biomers N/A Generation of N-Pxl1-Ppb1 chimera; Fw primer: 50 TATATGCT AGCATGACTTCGGGTCCTCATAATT 30 Sigma-Aldrich N/A Generation of N-Pxl1-Ppb1 chimera; Rv primer: 50 ATATAGG ATCCTACAAAGAGCTTTTCTTATCTG 30 Sigma-Aldrich N/A Creation of MBP-PPb1-HA; Fw primer: 50 ATATAT TCT AGA ATGACTTCGGGTCCTCATAATTTAG 30 Sigma-Aldrich N/A Creation of MBP-PPb1-HA; Rv primer: 50 ATATAT TCT AGA TCAGCACTGAGCAGCGTAATC 30 Sigma-Aldrich N/A Recombinant DNA pJK148-GFP-Pxl1-M3 This study N/A pJK148-GFP-Pxl1-M4 This study N/A pJK148-GFP-N-Pxl1-Ppb1 This study N/A (Continued on next page) e1 Cell Reports 25, 772–783.e1–e4, October 16, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER pJK148-N-Pxl1-Ppb1 This study N/A pJC20-GST-Pxl1 This study N/A pJC20-GST-Pxl1-M3 This study N/A pJC20-GST-Pxl1-M4 This study N/A pMAL-p2-Ppb1-HA This study N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ SoftWorx software 6.0 GE Healthcare N/A Graphpad Prism Graphpad Software https://www.graphpad.com Other m-slide 8 well uncoated Ibidi Cat#80821



    Similar Products

    93521 lectin  (Cell Signaling Technology Inc)
    90
    Cell Signaling Technology Inc 93521 lectin
    93521 Lectin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/93521+lectin/Cannabinoid+Receptor+1+Downstream+Signaling+Antibody+Sampler+Kit/pm30332655-251-91-84
    Average 90 stars, based on 1 article reviews
    93521 lectin - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results